Molecular Templates, Inc. (NASDAQ:MTEM)

About the company

Molecular Templates, Inc. is a clinical stage biopharmaceutical company, which engages in the discovery, development, and commercialization of biologic therapeutics for the treatment of cancers and other serious diseases. The company utilizes its proprietary biologic drug platform to design and generate engineered toxin bodies, or ETBs. Molecular Templates was founded by Eric E. Poma, Jean Gariépy and Leigh Revers on October 17, 2001 and is headquartered in Austin, TX.

Sector

Health Technology

Industry

Biotechnology

Employees

168

CEO

Eric E. Poma

Exchange

NASDAQ

Website

http://www.mtem.com

$19.00M

Total Revenue

168

Employees

$540.40M

Market Capitalization

-6.23

Price/Earning ratio

Stock price

Gross Margin (in %)

Total gross margin

$19M

Operating Margin (in %)

Total operating margin

$-63M

Net Margin (in %)

Total net margin

$-84M

Dividend Yield (in %)

Dividend per share

$0

Industry peers

Name Ticker Market capitalization (in USD Million) Revenues (in USD Million) Price/Book Price/Earning Net margin (in %)
Cyclacel Pharmaceuticals, Inc. CYCCP None 0.00 None None -748.10
Amgen, Inc. AMGN 155202.23 23966.00 16.02 20.22 32.02
Gilead Sciences, Inc. GILD 97269.90 22716.00 4.34 19.58 21.84
Vertex Pharmaceuticals, Inc. VRTX 76268.20 4819.00 11.68 50.45 31.35
Regeneron Pharmaceuticals, Inc. REGN 71581.75 8319.00 5.27 31.28 27.40
Illumina, Inc. ILMN 55591.90 3556.00 11.83 58.85 26.49
Biogen, Inc. BIIB 47986.72 14422.00 3.45 8.20 40.76
Seattle Genetics, Inc. SGEN 28397.04 956.00 16.57 -90.88 -32.82
Agilent Technologies, Inc. A 27845.52 5236.00 5.74 40.49 13.04
Alexion Pharmaceuticals, Inc. ALXN 25155.20 5296.00 2.11 10.60 44.83
Incyte Corp. INCY 23210.46 2229.00 11.95 -60.84 -16.87
BioMarin Pharmaceutical, Inc. BMRN 22947.18 1805.00 7.07 201.24 6.31
Moderna, Inc. MRNA 19738.09 53.00 13.25 -39.05 -961.85
Alnylam Pharmaceuticals, Inc. ALNY 16635.57 286.00 12.74 -18.73 -310.01
Sarepta Therapeutics, Inc. SRPT 12206.25 407.00 11.09 -18.35 -160.96
Neurocrine Biosciences, Inc. NBIX 12160.89 887.00 16.63 65.98 19.90
EXACT Sciences Corp. EXAS 11872.42 1062.00 5.12 -125.59 -10.05
Bio-Techne Corp. TECH 10498.02 755.00 7.97 56.67 24.76
10X Genomics, Inc. TXG 8819.02 264.00 21.63 -179.98 -18.45
Ionis Pharmaceuticals, Inc. IONS 8632.18 959.00 6.23 54.77 17.09
ACADIA Pharmaceuticals, Inc. ACAD 7741.50 366.00 12.59 -32.66 -64.99
Immunomedics, Inc. IMMU 7470.46 0.00 46.35 -20.63 -849.13
Exelixis, Inc. EXEL 7396.20 979.00 4.13 25.25 30.01
Acceleron Pharma, Inc. XLRN 5371.55 76.00 13.18 -39.13 -182.30
Ultragenyx Pharmaceutical, Inc. RARE 4990.32 122.00 8.44 -11.71 -348.78
CRISPR Therapeutics AG CRSP 4702.30 289.00 5.49 83.89 15.73
Allogene Therapeutics, Inc. ALLO 4675.84 None 10.29 -22.37 None
Mirati Therapeutics, Inc. MRTX 4562.61 2.00 7.78 -17.89 -761.40
Emergent BioSolutions, Inc. EBS 4456.24 1108.00 4.10 64.18 6.14
Arrowhead Pharmaceuticals, Inc. ARWR 4420.00 139.00 9.09 491.11 6.86
Vir Biotechnology, Inc. VIR 4354.56 10.00 12.48 -19.57 None
TESARO, Inc. TSRO 4122.80 219.00 -31.50 -6.32 -295.67
China Biologic Products Holdings, Inc. CBPO 4063.41 537.00 2.31 26.38 28.48
Halozyme Therapeutics, Inc. HALO 4048.42 164.00 66.30 -51.84 -48.75
Global Blood Therapeutics, Inc. GBT 4001.97 16.00 7.90 -13.84 None
Blueprint Medicines Corp. BPMC 3957.50 72.00 6.28 -10.70 -515.98
Amicus Therapeutics, Inc. FOLD 3903.05 209.00 9.97 -12.24 -155.73
FibroGen, Inc. FGEN 3784.50 257.00 8.46 -34.80 -42.75
Iovance Biotherapeutics, Inc. IOVA 3636.25 None 15.15 -15.81 None
Agios Pharmaceuticals, Inc. AGIO 3505.32 175.00 6.13 -9.49 -205.20
ChemoCentryx, Inc. CCXI 3422.59 33.00 65.18 -52.74 -194.82
Momenta Pharmaceuticals, Inc. MNTA 3356.08 29.00 8.87 -11.53 -994.16
bluebird bio, Inc. BLUE 3312.65 45.00 2.61 -4.21 -947.42
Arena Pharmaceuticals, Inc. ARNA 3218.10 6.00 3.62 -9.65 49.30
PTC Therapeutics, Inc. PTCT 3180.00 322.00 6.58 -11.06 -90.83
bluebird bio, Inc. BLUE 3127.30 54.00 2.82 -3.80 -947.42
Alkermes Plc ALKS 3075.63 1194.00 2.92 -22.52 -11.63
Deciphera Pharmaceuticals, Inc. DCPH 2665.37 25.00 4.71 -12.36 -868.56
Audentes Therapeutics, Inc. BOLD 2638.68 None 7.17 -15.11 None
Insmed, Inc. INSM 2602.16 151.00 14.42 -10.60 -162.82
Fate Therapeutics, Inc. FATE 2570.91 11.00 13.98 -22.92 -919.00
Denali Therapeutics, Inc. DNLI 2468.65 26.00 4.93 -11.52 -825.96
Novavax, Inc. NVAX 2449.20 18.00 -199.12 -20.51 -638.76
Viela Bio, Inc. VIE 2178.21 50.00 6.89 -20.53 -212.46
Ligand Pharmaceuticals, Inc. LGND 2121.16 110.00 2.71 -120.04 -55.63
Kodiak Sciences, Inc. KOD 1943.60 None 6.59 -30.75 None
uniQure NV QURE 1912.68 6.00 6.84 -15.18 -738.25
Xencor, Inc. XNCR 1903.56 77.00 3.16 -30.39 -79.39
TG Therapeutics, Inc. TGTX 1888.46 0.00 -2009.00 -10.00 None
Eidos Therapeutics, Inc. EIDX 1822.99 27.00 10.85 -37.61 -183.31
Dicerna Pharmaceuticals, Inc. DRNA 1796.90 55.00 10.65 -15.19 -213.04
Myovant Sciences Ltd. MYOV 1732.90 None -16.79 -5.98 None
Zentalis Pharmaceuticals, Inc. ZNTL 1678.95 0.00 -17.97 -29.43 None
Alector, Inc. ALEC 1642.89 23.00 4.80 -13.08 -556.70
Akebia Therapeutics, Inc. AKBA 1582.68 351.00 4.72 -5.92 -76.39
Editas Medicine, Inc. EDIT 1557.03 24.00 7.18 -11.02 -588.05
Twist Bioscience Corp. TWST 1523.28 66.00 7.77 -10.61 -222.66
Black Diamond Therapeutics, Inc. BDTX 1517.76 None 4.26 -34.84 None
Epizyme, Inc. EPZM 1487.08 17.00 5.26 -7.72 -727.88
Cytokinetics, Inc. CYTK 1464.97 22.00 -32.25 -11.13 -592.61
MacroGenics, Inc. MGNX 1445.50 68.00 7.60 -9.58 -222.14
Luminex Corp. LMNX 1444.96 343.00 3.25 -218.93 -1.76
Beam Therapeutics, Inc. BEAM 1414.63 0.00 5.68 -13.37 None
REGENXBIO, Inc. RGNX 1409.70 52.00 3.38 -13.75 -197.22
Intra-Cellular Therapies, Inc. ITCI 1404.18 1.00 3.74 -8.71 -981.67
Adverum Biotechnologies, Inc. ADVM 1394.94 0.00 5.49 -19.10 None
Coherus BioSciences, Inc. CHRS 1372.50 435.00 8.24 9.15 33.42
Cortexyme, Inc. CRTX 1330.81 None 6.19 -27.81 None
Veracyte, Inc. VCYT 1330.08 122.00 6.02 -60.24 -18.36
Heron Therapeutics, Inc. HRTX 1320.05 140.00 3.85 -6.84 -138.31
NGM Biopharmaceuticals, Inc. NGM 1305.60 102.00 4.10 -19.20 -52.41
Karyopharm Therapeutics, Inc. KPTI 1261.44 59.00 8.68 -6.77 -316.53
NanoString Technologies, Inc. NSTG 1261.08 124.00 9.78 -22.90 -46.13
Esperion Therapeutics, Inc. ESPR 1239.30 5.00 -25.22 -4.74 -65.49
Arvinas, Inc. ARVN 1195.25 45.00 6.31 -15.31 -171.74
NantKwest, Inc. NK 1187.01 0.00 11.53 -17.90 -969.27
Passage Bio, Inc. PASG 1151.55 None 3.00 -20.98 None
Sangamo Therapeutics, Inc. SGMO 1117.08 107.00 3.44 -11.89 -89.31
Intellia Therapeutics, Inc. NTLA 1092.70 46.00 5.28 -9.91 -239.98
Sorrento Therapeutics, Inc. SRNE 1068.60 33.00 14.27 -3.74 -754.90
Mersana Therapeutics, Inc. MRSN 1060.80 1.00 23.76 -12.85 -66.97
Aimmune Therapeutics, Inc. AIMT 1059.66 1.00 4.67 -3.79 None
Arcus Biosciences, Inc. RCUS 1058.20 15.00 7.89 -11.19 -631.95
Enanta Pharmaceuticals, Inc. ENTA 1048.74 176.00 2.06 44.19 13.46
Rocket Pharmaceuticals, Inc. RCKT 1045.50 None 3.95 -12.81 None
Meridian Bioscience, Inc. VIVO 1022.97 204.00 4.98 48.55 10.47
Translate Bio, Inc. TBIO 982.30 11.00 7.87 -10.51 -859.22
Retrophin, Inc. RTRX 893.54 184.00 3.97 -8.48 -57.01
BioXcel Therapeutics, Inc. BTAI 886.72 None 14.53 -22.20 None
Rhythm Pharmaceuticals, Inc. RYTM 858.00 None 3.83 -5.79 None
Myriad Genetics, Inc. MYGN 856.92 760.00 0.89 -5.79 -19.49
Atara Biotherapeutics, Inc. ATRA 807.40 None 3.42 -2.70 None
Morphic Holding, Inc. MORF 779.40 17.00 6.20 -14.35 -332.51
Omeros Corp. OMER 772.65 114.00 -6.26 -8.71 -78.52
CARA Therapeutics, Inc. CARA 770.88 24.00 5.11 -6.87 -480.29
Stoke Therapeutics, Inc. STOK 759.66 None 3.54 -20.19 None
Replimune Group, Inc. REPL 753.44 None 4.44 -14.39 None
Precigen, Inc. PGEN 751.92 98.00 9.45 -2.36 -324.18
ImmunoGen, Inc. IMGN 746.64 87.00 -244.00 -8.56 -102.87
Kura Oncology, Inc. KURA 725.56 None 4.54 -10.57 None
Sinovac Biotech Ltd. SVA 711.70 246.00 1.82 15.78 16.18
Frequency Therapeutics, Inc. FREQ 702.15 36.00 4.26 -37.13 -52.16
Homology Medicines, Inc. FIXX 674.96 2.00 3.06 -5.88 None
Rapt Therapeutics, Inc. RAPT 673.20 1.00 5.18 -14.53 None
Dynavax Technologies Corp. DVAX 667.59 40.00 78.82 -4.84 -319.06
XBiotech, Inc. XBIT 667.46 13.00 1.21 0.99 None
Kadmon Holdings, Inc. KDMN 660.80 12.00 7.87 -6.84 -831.11
Radius Health, Inc. RDUS 651.82 191.00 -8.86 -5.13 -66.82
Vanda Pharmaceuticals, Inc. VNDA 651.75 237.00 1.55 5.56 49.12
BioCryst Pharmaceuticals, Inc. BCRX 637.54 48.00 251.00 -5.58 -241.66
AnaptysBio, Inc. ANAB 608.58 23.00 1.53 -7.32 -363.13
NextCure, Inc. NXTC 592.76 27.00 1.76 -32.57 -65.22
ZIOPHARM Oncology, Inc. ZIOP 576.72 0.00 3.86 -4.56 None
Pacific Biosciences of California, Inc. PACB 575.96 90.00 9.59 -11.00 -58.35
Agenus, Inc. AGEN 558.78 85.00 -3.50 -3.22 -200.56
Cue Biopharma, Inc. CUE 549.36 4.00 14.40 -14.31 -959.05
Molecular Templates, Inc. MTEM 540.40 19.00 7.38 -6.23 -439.47
Avrobio, Inc. AVRO 533.10 None 2.50 -6.56 None
UroGen Pharma Ltd. URGN 532.56 0.00 3.70 -4.37 -255.27
Stemline Therapeutics, Inc. STML 532.35 47.00 4.21 -7.63 -150.30
Corbus Pharmaceuticals Holdings, Inc. CRBP 524.70 36.00 25.65 -7.10 -207.87
Prevail Therapeutics, Inc. PRVL 523.60 None 3.55 -7.33 None
Scholar Rock Holding Corp. SRRK 510.40 22.00 5.33 -8.76 -255.69
Flexion Therapeutics, Inc. FLXN 503.88 83.00 -9.75 -3.50 -175.76
Ardelyx, Inc. ARDX 498.42 6.00 3.73 -5.40 -153.19
Rubius Therapeutics, Inc. RUBY 493.75 None 2.14 -2.77 None
Syros Pharmaceuticals, Inc. SYRS 491.06 4.00 6.80 -6.42 None
Viking Therapeutics, Inc. VKTX 480.96 None 1.81 -15.90 None
Protagonist Therapeutics, Inc. PTGX 479.25 2.00 10.09 -5.69 -125.87
Voyager Therapeutics, Inc. VYGR 477.30 117.00 6.03 -12.17 -34.70
CEL-SCI Corp. CVM 473.55 0.00 42.28 -14.39 None
Syndax Pharmaceuticals, Inc. SNDX 466.56 2.00 9.85 -7.80 None
Neoleukin Therapeutics, Inc. NLTX 462.00 25.00 3.93 -5.26 -126.34
Personalis, Inc. PSNL 454.72 70.00 4.54 -15.62 -40.60
Prothena Corp. Plc PRTA 439.20 1.00 1.72 -5.44 -556.84
MeiraGTx Holdings Plc MGTX 431.20 17.00 2.49 -8.44 -313.73
Precision BioSciences, Inc. DTIL 429.42 24.00 3.79 -11.38 -369.86
Geron Corp. GERN 420.98 0.00 5.56 -5.56 -479.34
Athersys, Inc. ATHX 416.52 4.00 26.70 -8.90 -791.44
Merus NV MRUS 411.32 29.00 4.01 -6.13 -225.72
Puma Biotechnology, Inc. PBYI 410.67 224.00 43.87 -4.97 -36.74
Unity Biotechnology, Inc. UBX 403.20 1.00 4.19 -4.41 None
Avid Bioservices, Inc. CDMO 403.20 64.00 8.67 -40.00 -15.65
VBI Vaccines, Inc. VBIV 401.80 2.00 8.97 -7.97 None
MiMedx Group, Inc. MDXG 401.74 359.00 8.42 -13.54 -8.35
Harpoon Therapeutics, Inc. HARP 398.16 8.00 4.98 -7.72 -680.88
Clovis Oncology, Inc. CLVS 389.99 152.00 -4.59 -0.92 -271.12
CytomX Therapeutics, Inc. CTMX 386.86 78.00 5.53 -4.98 -97.82
Spectrum Pharmaceuticals, Inc. SPPI 380.73 109.00 2.60 -2.86 -109.77
Aspira Women's Health, Inc. AWH 372.60 5.00 81.00 -23.82 -307.31
Aptose Biosciences, Inc. APTO 372.29 0.00 5.54 -11.91 None
Vermillion, Inc. VRML 368.00 5.00 80.00 -23.53 -307.31
MannKind Corp. MNKD 361.58 62.00 -1.92 -7.78 -74.96
Xenon Pharmaceuticals, Inc. XENE 358.68 14.00 2.49 -9.56 -261.58
Progenics Pharmaceuticals, Inc. PGNX 352.60 37.00 11.71 -5.32 -180.28
PDL BioPharma, Inc. PDLI 340.47 54.00 0.61 -3.23 -201.30
Co-Diagnostics, Inc. CODX 340.02 2.00 26.99 -59.03 -334.77
Wave Life Sciences Ltd. WVE 336.94 17.00 17.09 -1.73 None
Rigel Pharmaceuticals, Inc. RIGL 320.88 102.00 4.06 -11.94 -27.39
Seres Therapeutics, Inc. MCRB 319.36 35.00 -5.87 -5.37 -186.09
Cellular Biomedicine Group, Inc. CBMG 316.35 0.00 7.15 -6.12 -776.23
Magenta Therapeutics, Inc. MGTA 310.83 None 2.51 -3.72 None
Brainstorm Cell Therapeutics, Inc. BCLI 292.80 None 39.35 -10.70 None
Calithera Biosciences, Inc. CALA 282.96 22.00 2.90 -3.14 -245.48
Immune Design Corp. IMDZ 280.80 2.00 3.08 -5.13 -720.81
Pfenex, Inc. PFNX 274.56 43.00 3.42 -92.44 -7.03
Cabaletta Bio, Inc. CABA 271.44 None 2.06 -13.00 None
Anavex Life Sciences Corp. AVXL 267.30 None 11.79 -10.31 None
Vaxart, Inc. VXRT 257.95 7.00 17.55 -10.53 -252.86
MediciNova, Inc. MNOV 248.60 6.00 3.40 -22.60 -67.11
Dyadic International, Inc. DYAI 245.97 2.00 7.29 -29.39 -523.67
CymaBay Therapeutics, Inc. CBAY 241.50 10.00 1.38 -2.59 -275.57
CASI Pharmaceuticals, Inc. CASI 235.71 8.00 3.47 -5.06 -614.25
Concert Pharmaceuticals, Inc. CNCE 231.75 0.00 1.78 -3.03 -533.31
IVERIC bio, Inc. ISEE 229.50 210.00 4.32 -3.72 54.39
Eiger BioPharmaceuticals, Inc. EIGR 228.24 None 5.53 -3.40 None
Jounce Therapeutics, Inc. JNCE 227.85 137.00 1.45 5.17 31.23
Lexicon Pharmaceuticals, Inc. LXRX 226.98 321.00 3.80 2.62 26.59
Five Prime Therapeutics, Inc. FPRX 214.20 18.00 1.67 -1.76 -679.63
Strongbridge Biopharma Plc SBBP 202.95 24.00 3.27 -3.69 -181.82
Aduro BioTech, Inc. ADRO 200.00 27.00 3.38 -3.01 -243.93
Chimerix, Inc. CMRX 183.28 11.00 1.94 -1.71 -923.39
Surface Oncology, Inc. SURF 182.70 40.00 2.19 -5.83 -70.90
Alpine Immune Sciences, Inc. ALPN 180.69 3.00 7.10 -5.06 -449.62
XOMA Corp. XOMA 180.27 11.00 5.37 -21.31 -78.07
Paratek Pharmaceuticals, Inc. PRTK 180.25 23.00 -4.02 -1.48 -528.28
ADMA Biologics, Inc. ADMA 176.29 36.00 2.58 -3.32 -151.18
Chiasma, Inc. CHMA 175.89 13.00 2.65 -4.25 -22.14
Fennec Pharmaceuticals, Inc. FENC 164.40 None 24.91 -11.74 None
Selecta Biosciences, Inc. SELB 164.40 7.00 -27.40 -2.45 -943.39
GlycoMimetics, Inc. GLYC 161.68 9.00 1.10 -3.16 -571.90
Galectin Therapeutics, Inc. GALT 160.60 None 4.11 -11.68 None
Pieris Pharmaceuticals, Inc. PIRS 159.12 51.00 3.22 -7.12 -42.26
Fortress Biotech, Inc. FBIO 156.02 43.00 5.98 -2.83 -124.73
Dermira, Inc. DERM 150.00 11.00 29.30 -13.30 -102.68
Aravive, Inc. ARAV 149.37 3.00 3.11 -6.14 -796.01
Trevena, Inc. TRVN 143.82 0.00 5.67 -5.67 -537.06
X4 Pharmaceuticals, Inc. XFOR 143.52 3.00 1.22 6.06 None
Pluristem Therapeutics, Inc. PSTI 142.72 0.00 15.65 -4.96 -816.51
Minerva Neurosciences, Inc. NERV 138.84 None 7.57 -2.03 None
Verastem, Inc. VSTM 138.61 21.00 2.20 -0.91 -715.40
Harvard Bioscience, Inc. HBIO 137.94 112.00 1.83 -20.17 -6.11
Champions Oncology, Inc. CSBR 137.20 31.00 37.69 -980.00 -0.58
Evofem Biosciences, Inc. EVFM 137.08 0.00 298.00 -1.73 None
Solid Biosciences, Inc. SLDB 132.00 None 2.44 -1.15 None
Applied Genetic Technologies Corp. AGTC 122.17 3.00 1.95 -2.95 -4.81
Eloxx Pharmaceuticals, Inc. ELOX 122.07 0.00 4.82 -2.30 None
Axcella Health, Inc. AXLA 121.67 None 4.04 -1.96 None
Kezar Life Sciences, Inc. KZR 120.75 None 1.96 -3.02 None
La Jolla Pharmaceutical Co. LJPC 119.07 26.00 -1.84 -1.28 -355.86
Lineage Cell Therapeutics, Inc. LCTX 118.50 3.00 1.11 -1.80 -333.12
Aldeyra Therapeutics, Inc. ALDX 116.76 None 2.86 -2.09 None
Palatin Technologies, Inc. PTN 114.24 60.00 1.26 2.67 61.44
Cidara Therapeutics, Inc. CDTX 113.77 23.00 2.80 -2.84 -178.43
Arbutus Biopharma Corp. ABUS 112.80 7.00 -1.94 -0.70 -797.42
Enzo Biochem, Inc. ENZ 111.36 77.00 1.78 -3.57 -39.50
Recro Pharma, Inc. REPH 110.40 96.00 -8.85 -4.30 -25.38
Otonomy, Inc. OTIC 97.96 1.00 3.26 -2.19 None
Savara, Inc. SVRA 95.85 0.00 1.28 -1.13 None
22nd Century Group, Inc. XXII 95.07 27.00 1.75 -3.35 -107.21
Orgenesis, Inc. ORGS 92.64 28.00 1.42 1.92 199.32
BioNTech US, Inc. NTGN 85.96 None 3.01 -1.07 None
DiaMedica Therapeutics, Inc. DMAC 85.80 1.00 7.61 -8.83 None
Windtree Therapeutics, Inc. WINT 84.00 0.00 1.37 -2.93 None
Catabasis Pharmaceuticals, Inc. CATB 83.33 1.00 2.14 -2.87 None
resTORbio, Inc. TORC 83.16 None 1.12 -1.04 None
Monopar Therapeutics, Inc. MNPR 82.28 None 6.39 -20.22 None
Lumos Pharma, Inc. LUMO 81.15 1.00 1.11 -1.67 -429.65
Organovo Holdings, Inc. ONVO 80.60 2.00 3.10 -4.43 -852.00
vTv Therapeutics, Inc. VTVT 79.45 2.00 -2.52 -5.16 -905.13
iBio, Inc. IBIO 78.40 1.00 65.33 -2.02 -884.69
AVEO Pharmaceuticals, Inc. AVEO 78.24 28.00 18.11 97.80 1.62
Catalyst Biosciences, Inc. CBIO 75.53 16.00 1.31 -1.60 -269.75
AquaBounty Technologies, Inc. AQB 71.30 0.00 2.84 -5.25 None
ContraFect Corp. CFRX 69.90 None 22.55 -2.00 None
Sesen Bio, Inc. SESN 69.89 0.00 4.15 -0.89 6.31
Proteostasis Therapeutics, Inc. PTI 69.87 5.00 1.36 -1.28 -460.52
Axovant Gene Therapies Ltd. AXGT 68.75 None 1.80 -0.94 None
Anixa Biosciences, Inc. ANIX 66.78 0.00 13.83 -6.91 -14.90
T2 Biosystems, Inc. TTOO 66.04 9.00 -21.17 -1.08 -646.60
Synlogic, Inc. SYBX 64.35 2.00 0.45 -1.18 None
Sierra Oncology, Inc. SRRA 59.75 None 0.96 -0.45 None
INmune Bio, Inc. INMB 55.00 None 2.42 -6.76 None
Nabriva Therapeutics Plc NBRV 54.92 7.00 4.84 -0.63 None
Idera Pharmaceuticals, Inc. IDRA 54.90 1.00 1.44 -0.78 -236.98
Genocea Biosciences, Inc. GNCA 54.25 0.00 4.82 -1.92 -766.21
Leap Therapeutics, Inc. LPTX 53.82 0.00 6.47 -1.34 None
NeuroBo Pharmaceuticals, Inc. NRBO 51.48 None 18.26 -3.50 None
Infinity Pharmaceuticals, Inc. INFI 50.73 1.00 -22.25 -1.14 -50.81
Equillium, Inc. EQ 47.26 None 1.35 -1.76 None
Actinium Pharmaceuticals, Inc. ATNM 46.79 None 31.40 -2.09 None
Vaccinex, Inc. VCNX 46.62 0.00 -2.16 -1.56 None
Opiant Pharmaceuticals, Inc. OPNT 45.65 39.00 1.15 4.13 29.58
Vascular Biogenics Ltd. VBLT 43.96 1.00 1.85 -2.14 -73.12
Merrimack Pharmaceuticals, Inc. MACK 43.55 144.00 2.48 -6.70 -105.18
Bellicum Pharmaceuticals, Inc. BLCM 41.70 7.00 -5.87 -0.48 -410.63
Soligenix, Inc. SNGX 41.16 4.00 15.08 -2.76 -346.90
Outlook Therapeutics, Inc. OTLK 41.12 6.00 -6.76 -1.38 -789.06
Curis, Inc. CRIS 40.12 11.00 -1.07 -1.24 -292.03
Entasis Therapeutics Holdings, Inc. ETTX 38.35 7.00 2.89 -0.85 -659.64
Miragen Therapeutics, Inc. MGEN 37.10 5.00 2.08 -0.93 -778.69
Zafgen, Inc. ZFGN 36.63 None 0.73 -1.02 None
OncoMed Pharmaceuticals, Inc. OMED 36.48 44.00 0.77 -4.57 -18.24
NanoViricides, Inc. NNVC 36.25 None 4.59 -2.35 None
Armata Pharmaceuticals, Inc. ARMP 35.73 0.00 2.21 -1.77 -167.17
Microbot Medical, Inc. MBOT 35.25 0.00 1.69 -4.61 None
Acorda Therapeutics, Inc. ACOR 35.04 176.00 0.11 -0.15 -131.45
Pulmatrix, Inc. PULM 35.00 11.00 6.48 -2.43 -188.59
Heat Biologics, Inc. HTBX 33.93 3.00 2.72 -1.61 -633.68
Oragenics, Inc. OGEN 31.74 1.00 6.90 -1.86 -996.00
Onconova Therapeutics, Inc. ONTX 30.74 2.00 4.46 -2.52 -876.56
HTG Molecular Diagnostics, Inc. HTGM 30.36 18.00 1.85 -1.62 -106.35
Sunesis Pharmaceuticals, Inc. SNSS 29.00 2.00 3.22 -1.32 -749.95
Alimera Sciences, Inc. ALIM 28.80 56.00 -0.81 -3.13 -15.97
Seelos Therapeutics, Inc. SEEL 27.54 0.00 6.80 0.77 -128.98
Aptevo Therapeutics, Inc. APVO 27.54 32.00 1.96 -1.72 -78.75
NovaBay Pharmaceuticals, Inc. NBY 25.92 7.00 -108.00 -3.72 -112.57
Cleveland BioLabs, Inc. CBLI 24.64 1.00 -6.79 -11.20 -220.48
9 Meters Biopharma, Inc. NMTR 23.68 2.00 -4.92 -0.86 -468.45
Capricor Therapeutics, Inc. CAPR 22.95 1.00 6.85 -2.85 -750.59
Advaxis, Inc. ADXS 22.76 0.00 0.96 -0.28 -79.54
AzurRx BioPharma, Inc. AZRX 22.43 None 8.15 -1.45 None
India Globalization Capital, Inc. IGC 22.40 6.00 0.74 -3.29 -102.76
VistaGen Therapeutics, Inc. VTGN 21.73 1.00 -4.42 -0.91 -929.89
AIM ImmunoTech, Inc. AIM 19.44 0.00 2.31 34.71 None
Conatus Pharmaceuticals, Inc. CNAT 18.48 15.00 1.06 -1.87 -68.87
Correvio Pharma Corp. CORV 18.48 33.00 -41.99 -0.53 -107.81
Iterum Therapeutics Plc ITRM 17.85 0.00 -0.51 -0.18 None
aTyr Pharma, Inc. LIFE 17.04 8.00 0.95 -1.00 -185.14
Bio-Path Holdings, Inc. BPTH 15.21 0.00 1.04 -1.56 None
BioCardia, Inc. BCDA 14.88 1.00 -24.80 -1.02 62.28
Unum Therapeutics, Inc. UMRX 13.35 26.00 0.54 -0.52 -99.09
Diffusion Pharmaceuticals, Inc. DFFN 13.30 0.00 3.17 -0.93 None
Cellectar BioSciences, Inc. CLRB 12.69 0.00 8.29 -0.94 None
Rexahn Pharmaceuticals, Inc. REXN 11.40 1.00 1.21 -1.67 -598.19
SELLAS Life Sciences Group, Inc. SLS 11.12 9.00 2.32 -6.04 -392.81
Aevi Genomic Medicine, Inc. GNMX 10.78 None -4.15 -0.57 None
BioNano Genomics, Inc. BNGO 10.29 9.00 -9.80 -0.32 -345.00
Precipio, Inc. PRPO 9.10 4.00 1.29 -0.49 -499.72
Synthetic Biologics, Inc. SYN 8.51 3.00 -1.73 -0.54 -54.07
ENDRA Life Sciences, Inc. NDRA 8.09 0.00 5.29 -0.40 -538.30
TRACON Pharmaceuticals, Inc. TCON 7.72 3.00 3.78 -0.33 -218.20
ARCA biopharma, Inc. ABIO 6.74 None 2.07 -2.16 None
Ocugen, Inc. OCGN 5.97 0.00 3.16 0.04 None
Achieve Life Sciences, Inc. ACHV 5.60 5.00 1.00 -0.33 -397.65
Cyclacel Pharmaceuticals, Inc. CYCC 4.53 0.00 2.12 -0.53 -748.10
Plus Therapeutics, Inc. PSTV 4.24 6.00 106.00 5.73 -147.01
Xenetic Biosciences, Inc. XBIO 4.16 0.00 0.40 -14.86 -47.40
AIkido Pharma, Inc. AIKI 3.34 0.00 1.39 -0.42 -267.48
Seneca Biopharma, Inc. SNCA 2.88 0.00 1.24 -0.55 None
Tocagen, Inc. TOCA 2.52 0.00 0.96 -0.04 -271.43
Phio Pharmaceuticals Corp. PHIO 2.20 0.00 0.84 -0.15 None
Spherix, Inc. SPEX 1.83 0.00 0.00 -0.37 -267.48
Invivo Therapeutics Holdings Corp. NVIV 1.54 None 0.79 -0.05 None
Sophiris Bio, Inc. SPHS 0.31 5.00 -0.12 -0.04 -222.98
SenesTech, Inc. SNES 0.00 0.00 3.33 -0.01 None

Latest insider transactions

Date Role Name Transaction Quantity Quantity Owned After

Molecular Templates’ Presentations at the American Association of Cancer Research (AACR) Annual Meeting 2020 Highlight Evolution of ETB Platform

13d ago, source: YAHOO!

AUSTIN, Texas, June 22, 2020 (GLOBE NEWSWIRE) -- Molecular Templates, Inc. (Nasdaq: MTEM, “Molecular Templates,” “MTEM” or the “Company”), a clinical ...

MTEM Molecular Templates, Inc. Common Stock

13d ago, source: Nasdaq

Investors may trade in the Pre-Market (4:00-9:30 a.m. ET) and the After Hours Market (4:00-8:00 p.m. ET). Participation from Market Makers and ECNs is strictly voluntary and as a result, these ...

Is Molecular Templates, Inc. (MTEM) A Good Stock To Buy?

10d ago, source: Insider Monkey

Before we spend countless hours researching a company, we like to analyze what insiders, hedge funds and billionaire ...

Threshold Pharmaceuticals Registered (MTEM) Stock

8d ago, source: Business Insider

Inc. MORE Molecular Templates, Inc. is a clinical stage biopharmaceutical company, which engages in the discovery, development, and commercialization of biologic therapeutics for the treatment of ...

Molecular Templates Inc.

1mon ago, source: MarketWatch

08/03/2018 N/A S-8 POS Registration Statement 06/22/2018 N/A S-8 Registration Statement 10/18/2017 N/A S-8 Registration Statement 03/10/2016 N/A S-8 Registration Statement 03/03/2015 N/A S-8 ...

Legend Biotech Announces Three New Appointments to the Board of Directors

25d ago, source: Business Wire

Dr. Sanders currently serves as a member of the Board of Directors of Molecular Templates, Inc and of AbGenomics International, Inc. Dr. Ji joined the Legend Biotech Board of Directors in May 2020 ...

Dynamic and scalable DNA-based information storage

22d ago, source: Nature

1: Molecular technologies unlock dynamic operations ... ss-dsDNA strands were created by filling in ssDNA templates (IDT DNA) with primer TCTGCTCTGCACTCGTAATAC (Eton Bioscience) at a ratio of ...



Portfolio items

Follow companies to create your optimal portfolio.
or
Refresh this page to see your newly added stocks.